Control shRNAs

VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
shRNA Target Sequences Click to send design request Click to start designing your vector
Name Target Sequence Target Gene Target Position References Sequence
Scramble_shRNA_target CCTAAGGTTAAGTCGCCCTCG None in human and mouse Cancer Res. 66:9270 (2006) View
EGFP[shRNA#1]_target CGACGTAAACGGCCACAAGTT EGFP 63-83 The RNAi Consortium ID: TRCN0000072193 View
EGFP[shRNA#2]_target ACGTCTATATCATGGCCGACA EGFP 449-469 The RNAi Consortium ID: TRCN0000231756 View
LacZ[shRNA#1]_target GTCGGCTTACGGCGGTGATTT LacZ 1734-1754 The RNAi Consortium ID: TRCN0000072242 View
LacZ[shRNA#2]_target GTTCCGTCATAGCGATAACGA LacZ 1908-1928 The RNAi Consortium ID: TRCN0000072238 View
Luciferase[shRNA#1]_target ATGTTTACTACACTCGGATAT Firefly luciferase 745-765 The RNAi Consortium ID: TRCN0000231737 View
Luciferase[shRNA#2]_target TGTCCGGTTATGTAAACAATC Firefly luciferase 1193-1213 The RNAi Consortium ID: TRCN0000072258 View