{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9260tnw
Vector Name:
Vector Type:
Mammalian shRNA Knockdown AAV Vector   Guide 
Vector Size:
5344 bp
Viral Genome Size:
2227 bp undersized genome oversized genome oversized genome
shRNA:
EGFP[shRNA#2]
Target Sequence:
ACGTCTATATCATGGCCGACA
Marker:
mCherry
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-141 141 View Details
misc_feature1 142-147 6 View Details
U6 promoter 148-396 249 View Details
DeltaAgeI 397-398 2 View Details
EGFP[shRNA#2] 399-446 48 View Details
terminator2 447-451 5 View Details
EcoRI 452-457 6 View Details
misc_feature4 458-478 21 View Details
PGK promoter 479-1067 589 View Details
misc_feature5 1068-1097 30 View Details
mCherry 1098-1808 711 View Details
misc_feature6 1809-1852 44 View Details
SV40 late pA 1853-2074 222 View Details
misc_feature7 2075-2086 12 View Details
3' ITR complement
(
2087-2227 )
141 View Details
misc_feature8 2228-3307 1080 View Details
Ampicillin 3308-4168 861 View Details
misc_feature9 4169-4338 170 View Details
pUC ori 4339-4927 589 View Details
misc_feature10 4928-5344 417 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

e1665012dc066ac5f08e7aafe29ab803