Vector Information

Vector Summary

Vector ID :
VB180124-1069tzr
Vector Name :
pLV[msgRNA]-EGFP/Puro-U6>Scramble_gRNA
Vector Type :
Mammalian msgRNA Expression Lentiviral Vector   Guide 
Vector Size :
8469 bp
Viral Genome Size :
4994 bp oversized genome
gRNA:
Scramble_gRNA
Guide Sequence:
GCACTACCAGAGCTAACTCA
Marker:
EGFP:T2A:Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable :
    E. coli stock
  • Cloning Host Strain : {[ obj.cloning_host|boatFixI18n|translate ]}
Price Price(No Tax) {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days
Price Price(No Tax) : Inquiry being processed
Added to My shopping cart

  • Plasmid DNA Preparation From $39.00
  • Lentivirus Packaging From $399.00
  • CRISPRa Transcriptional Activator Expression Vectors (for dCas9-SAM System) From $159.00
  • Control Vectors From $99.00

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
RSV promoter 1-229 229 View Details
Δ5' LTR 230-410 181 View Details
misc_feature1 411-520 110 View Details
Ψ 521-565 45 View Details
misc_feature2 566-1074 509 View Details
RRE 1075-1308 234 View Details
misc_feature3 1309-1802 494 View Details
cPPT 1803-1920 118 View Details
misc_feature4 1921-1926 6 View Details
U6 promoter 1927-2175 249 View Details
misc_feature 2176-2176 1 View Details
Scramble_gRNA 2177-2334 158 View Details
Terminator 2335-2339 5 View Details
misc_feature 2340-2379 40 View Details
hPGK promoter 2380-2884 505 View Details
misc_feature8 2885-2914 30 View Details
EGFP:T2A:Puro 2915-4294 1380 View Details
misc_feature9 4295-4325 31 View Details
WPRE 4326-4923 598 View Details
misc_feature11 4924-4988 65 View Details
ΔU3/3' LTR 4989-5223 235 View Details
misc_feature10 5224-5295 72 View Details
SV40 early pA 5296-5430 135 View Details
misc_feature11 5431-6383 953 View Details
Ampicillin 6384-7244 861 View Details
misc_feature12 7245-7414 170 View Details
pUC ori 7415-8003 589 View Details
misc_feature13 8004-8469 466 View Details

Note: Components added by user are listed in bold red text.

9b3c866b4a2800ebc4988efc74e202fb