Vector Information

Vector Summary

Vector ID :
VB181225-1325hfs
Vector Name :
pAAV[gRNA]-EGFP/Puro-U6>Scramble_SagRNA1
Vector Type :
Mammalian Single-SagRNA Expression AAV Vector   Guide 
Vector Size :
6070 bp
Viral Genome Size :
2953 bp oversized genome
gRNA:
Scramble_gRNA3
Guide Sequence:
GTGTAGTTCGACCATTCGTG
Marker:
EGFP:P2A:Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable :
    E. coli stock
  • Cloning Host Strain : {[ obj.cloning_host|boatFixI18n|translate ]}
Price Price(No Tax) {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days
Price Price(No Tax) : Inquiry being processed
Added to My shopping cart

  • Plasmid DNA Preparation From $39.00
  • AAV Packaging From $399.00
  • Cas9 Expression Vectors From $159.00
  • Control Vectors From $99.00

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
misc_feature 1-236 236 View Details
5' ITR 237-377 141 View Details
misc_feature1 378-383 6 View Details
U6 promoter 384-632 249 View Details
misc_feature 633-633 1 View Details
Scramble_gRNA3 634-729 96 View Details
Terminator 730-734 5 View Details
Undefined 735-768 34 View Details
CMV promoter 769-1357 589 View Details
misc_feature8 1358-1387 30 View Details
EGFP:P2A:Puro 1388-2770 1383 View Details
attB2 2771-2794 24 View Details
misc_feature5 2795-2814 20 View Details
SV40 late pA 2815-3036 222 View Details
misc_feature6 3037-3048 12 View Details
3' ITR complement
(
3049-3189 )
141 View Details
misc_feature7 3190-4269 1080 View Details
Ampicillin 4270-5130 861 View Details
misc_feature12 5131-5300 170 View Details
pUC ori 5301-5889 589 View Details
misc_feature 5890-6070 181 View Details

Note: Components added by user are listed in bold red text.

222a2509c333c39d1ba7a9e45971fdeb