Click to refer colleagues and get 30% off
{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9344czv
Vector Name:
Vector Type:
Mammalian shRNA Knockdown scAAV Vector   Guide 
Vector Size:
4916 bp
shRNA:
Scramble_shRNA
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
mCherry
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information How to order

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-143 143 View Details
Undefined 144-167 24 View Details
U6 promoter 168-416 249 View Details
DeltaAgeI 417-418 2 View Details
Scramble_shRNA 419-466 48 View Details
Terminator 467-471 5 View Details
Undefined 472-504 33 View Details
CMV promoter 505-1093 589 View Details
misc_feature8 1094-1123 30 View Details
mCherry 1124-1834 711 View Details
misc_feature6 1835-1878 44 View Details
SV40 late pA 1879-2100 222 View Details
misc_feature4 2101-2106 6 View Details
3' ITR Δtrs 2107-2219 113 View Details
Undefined 2220-2844 625 View Details
Ampicillin 2845-3705 861 View Details
misc_feature12 3706-3875 170 View Details
pUC ori 3876-4464 589 View Details
Undefined 4465-4916 452 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

80dfbf883465998714c4ccd1754a6918
Request Design Support