{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-0020ytx
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Adenoviral Vector   Guide 
Vector Size:
34989 bp
Viral Genome Size:
32907 bp undersized genome oversized genome
shRNA:
Scramble_shRNA#1
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information How to order

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature 104-190 87 View Details
Ψ 191-370 180 View Details
misc_feature 371-536 166 View Details
U6 promoter 537-785 249 View Details
misc_feature 786-787 2 View Details
Scramble_shRNA#1 788-835 48 View Details
Terminator 836-840 5 View Details
misc_feature 841-864 24 View Details
hPGK promoter 865-1369 505 View Details
Kozak 1370-1375 6 View Details
EGFP 1376-2095 720 View Details
SV40 late pA 2096-2317 222 View Details
misc_feature 2318-2365 48 View Details
ΔAd5 2366-32804 30439 View Details
3' ITR 32805-32907 103 View Details
PacI 32908-32915 8 View Details
misc_feature 32916-33130 215 View Details
pBR322 ori complement
(
33131-33719 )
589 View Details
misc_feature 33720-33870 151 View Details
AmpiciIIin complement
(
33871-34731 )
861 View Details
misc_feature 34732-34981 250 View Details
PacI 34982-34989 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

9a1dac86ceb5fb42562dc6178464030b