{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-0020ytx
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Adenoviral Vector   Guide 
Vector Size:
34996 bp
shRNA:
Scramble_shRNA#1
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature 104-190 87 View Details
Ψ 191-370 180 View Details
misc_feature 371-536 166 View Details
U6 promoter 537-785 249 View Details
misc_feature 786-787 2 View Details
Scramble_shRNA#1 788-835 48 View Details
Terminator 836-840 5 View Details
misc_feature 841-864 24 View Details
hPGK promoter 865-1369 505 View Details
Kozak 1370-1375 6 View Details
EGFP 1376-2095 720 View Details
SV40 late pA 2096-2317 222 View Details
misc_feature 2318-2365 48 View Details
ΔAd5 2366-32811 30446 View Details
3' ITR 32812-32914 103 View Details
PacI 32915-32922 8 View Details
misc_feature 32923-33137 215 View Details
pBR322 ori complement
(
33138-33726 )
589 View Details
misc_feature 33727-33877 151 View Details
AmpiciIIin complement
(
33878-34738 )
861 View Details
misc_feature 34739-34988 250 View Details
PacI 34989-34996 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

9a1dac86ceb5fb42562dc6178464030b