{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-0023jze
Vector Name:
Vector Type:
Mammalian shRNA Knockdown AAV Vector   Guide 
Vector Size:
5353 bp
Viral Genome Size:
2214 bp undersized genome oversized genome oversized genome
shRNA:
Scramble[shRNA#1]
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart View how to order

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-130 130 View Details
misc_feature1 131-136 6 View Details
U6 promoter 137-385 249 View Details
DeltaAgeI 386-387 2 View Details
Scramble[shRNA#1] 388-435 48 View Details
terminator2 436-440 5 View Details
EcoRI 441-446 6 View Details
misc_feature4 447-467 21 View Details
CMV promoter 468-1056 589 View Details
misc_feature5 1057-1086 30 View Details
EGFP 1087-1806 720 View Details
misc_feature6 1807-1850 44 View Details
SV40 late pA 1851-2072 222 View Details
misc_feature7 2073-2084 12 View Details
3' ITR complement
(
2085-2214 )
130 View Details
misc_feature 2215-2225 11 View Details
misc_feature8 2226-3305 1080 View Details
Ampicillin 3306-4166 861 View Details
misc_feature9 4167-4336 170 View Details
pUC ori 4337-4925 589 View Details
misc_feature10 4926-5342 417 View Details
misc_feature 5343-5353 11 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

7972e5597dc8a7286e80f923307ebfc5