{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-0039sus
Vector Name:
Vector Type:
Mammalian shRNA Knockdown PiggyBac Vector   Guide 
Vector Size:
5816 bp
shRNA:
Scramble[shRNA#1]
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information How to order

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-313 313 View Details
U6 promoter 314-562 249 View Details
DeltaAgeI 563-564 2 View Details
Scramble[shRNA#1] 565-612 48 View Details
terminator2 613-617 5 View Details
EcoRI 618-623 6 View Details
misc_feature3 624-652 29 View Details
PGK promoter 653-1157 505 View Details
misc_feature4 1158-1187 30 View Details
Puro 1188-1787 600 View Details
misc_feature5 1788-1814 27 View Details
rBG pA 1815-2336 522 View Details
misc_feature6 2337-2545 209 View Details
3' ITR complement
(
2546-2780 )
235 View Details
misc_feature7 2781-3611 831 View Details
Ampicillin 3612-4472 861 View Details
misc_feature8 4473-4642 170 View Details
pUC ori 4643-5231 589 View Details
misc_feature9 5232-5816 585 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

cf532af9131e5029545741253043deb8