{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-0042aff
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Lentiviral Vector   Guide 
Vector Size:
8542 bp
Viral Genome Size:
5067 bp undersized genome oversized genome
shRNA:
Luciferase[shRNA#1]
Target Sequence:
ATGTTTACTACACTCGGATAT
Marker:
EGFP:T2A:Neo
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information How to order

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
RSV promoter 1-229 229 View Details
Delta5' LTR 230-410 181 View Details
misc_feature1 411-520 110 View Details
Psi 521-565 45 View Details
misc_feature2 566-1074 509 View Details
RRE 1075-1308 234 View Details
misc_feature3 1309-1802 494 View Details
cPPT 1803-1920 118 View Details
misc_feature4 1921-1926 6 View Details
U6 promoter 1927-2175 249 View Details
DeltaAgeI 2176-2177 2 View Details
Luciferase[shRNA#1] 2178-2225 48 View Details
terminator2 2226-2230 5 View Details
EcoRI 2231-2236 6 View Details
misc_feature7 2237-2257 21 View Details
PGK promoter 2258-2762 505 View Details
misc_feature8 2763-2792 30 View Details
EGFP:T2A:Neo 2793-4367 1575 View Details
misc_feature9 4368-4398 31 View Details
WPRE 4399-4996 598 View Details
misc_feature10 4997-5061 65 View Details
DeltaU3/3' LTR 5062-5296 235 View Details
misc_feature11 5297-5368 72 View Details
SV40 early pA 5369-5503 135 View Details
misc_feature12 5504-6456 953 View Details
Ampicillin 6457-7317 861 View Details
misc_feature13 7318-7487 170 View Details
pUC ori 7488-8076 589 View Details
misc_feature14 8077-8542 466 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

7e70e0fb109aa3d57ec7aaa7bf6aeb4d