{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-0043mch
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Adenoviral Vector   Guide 
Vector Size:
34988 bp
Viral Genome Size:
32906 bp undersized genome oversized genome oversized genome
shRNA:
Luciferase[shRNA#1]
Target Sequence:
ATGTTTACTACACTCGGATAT
Marker:
mCherry
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature1 104-190 87 View Details
Psi 191-370 180 View Details
misc_feature2 371-512 142 View Details
attB1 513-536 24 View Details
U6 promoter 537-785 249 View Details
DeltaAgeI 786-787 2 View Details
Luciferase[shRNA#1] 788-835 48 View Details
terminator2 836-840 5 View Details
EcoRI 841-846 6 View Details
undefinded19 847-865 19 View Details
PGK promoter 866-1370 505 View Details
Kozak 1371-1376 6 View Details
mCherry 1377-2087 711 View Details
SV40 late pA 2088-2309 222 View Details
BamHI 2310-2315 6 View Details
attB2 2316-2339 24 View Details
misc_feature6 2340-2357 18 View Details
wt Ad5(DeltaE3) 2358-32803 30446 View Details
3' ITR 32804-32906 103 View Details
PacI 32907-32914 8 View Details
misc_feature7 32915-33129 215 View Details
pUC* ori complement
(
33130-33718 )
589 View Details
misc_feature8 33719-33869 151 View Details
Ampicillin complement
(
33870-34730 )
861 View Details
misc_feature9 34731-34980 250 View Details
PacI 34981-34988 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

f28cb5c913dac5eea3bf747f5739dbd3