{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9258qsm
Vector Name:
Vector Type:
Mammalian shRNA Knockdown PiggyBac Vector   Guide 
Vector Size:
6578 bp
shRNA:
Scramble[shRNA#1]
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
TagBFP2:T2A:Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-313 313 View Details
U6 promoter 314-562 249 View Details
DeltaAgeI 563-564 2 View Details
Scramble[shRNA#1] 565-612 48 View Details
terminator2 613-617 5 View Details
EcoRI 618-623 6 View Details
misc_feature3 624-652 29 View Details
PGK promoter 653-1157 505 View Details
misc_feature4 1158-1187 30 View Details
TagBFP2:T2A:Puro 1188-2549 1362 View Details
misc_feature5 2550-2576 27 View Details
rBG pA 2577-3098 522 View Details
misc_feature6 3099-3307 209 View Details
3' ITR complement
(
3308-3542 )
235 View Details
misc_feature7 3543-4373 831 View Details
Ampicillin 4374-5234 861 View Details
misc_feature8 5235-5404 170 View Details
pUC ori 5405-5993 589 View Details
misc_feature9 5994-6578 585 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

4a5420d8529017472a28b32e83144e4f