{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9343nhh
Vector Name:
Vector Type:
Mammalian shRNA Knockdown scAAV Vector   Guide 
Vector Size:
4925 bp
shRNA:
Scramble_shRNA
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart View how to order

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-143 143 View Details
Undefined 144-167 24 View Details
U6 promoter 168-416 249 View Details
DeltaAgeI 417-418 2 View Details
Scramble_shRNA 419-466 48 View Details
Terminator 467-471 5 View Details
Undefined 472-504 33 View Details
CMV promoter 505-1093 589 View Details
misc_feature8 1094-1123 30 View Details
EGFP 1124-1843 720 View Details
misc_feature6 1844-1887 44 View Details
SV40 late pA 1888-2109 222 View Details
misc_feature4 2110-2115 6 View Details
3' ITR Δtrs 2116-2228 113 View Details
Undefined 2229-2853 625 View Details
Ampicillin 2854-3714 861 View Details
misc_feature12 3715-3884 170 View Details
pUC ori 3885-4473 589 View Details
Undefined 4474-4925 452 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

50fb260af895c2a0c92d31c44525cc32