{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9350dnk
Vector Name:
Vector Type:
Mammalian miR30-shRNA Knockdown Adenoviral Vector   Guide 
Vector Size:
35173 bp
Promoter:
CMV
ORF:
EGFP
shRNA:
Scramble[miR30-shRNA]
Target Sequence:
ACCTAAGGTTAAGTCGCCCTCG
Plasmid Copy Number:
Medium
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature1 104-190 87 View Details
Ψ 191-370 180 View Details
misc_feature 371-510 140 View Details
attB4 511-531 21 View Details
CMV 532-1120 589 View Details
attB1 1121-1144 24 View Details
Kozak 1145-1150 6 View Details
EGFP 1151-1870 720 View Details
attB2 1871-1894 24 View Details
5' miR-30E 1895-2022 128 View Details
Scramble[miR30-shRNA] 2023-2085 63 View Details
3' miR-30E 2086-2215 130 View Details
attB3 2216-2236 21 View Details
misc_feature5 2237-2254 18 View Details
TK pA 2255-2526 272 View Details
misc_feature 2527-2543 17 View Details
ΔAd5 2544-32537 29994 View Details
misc_feature 32538-32983 446 View Details
3' ITR 32984-33086 103 View Details
PacI 33087-33094 8 View Details
misc_feature 33095-33309 215 View Details
pBR322 ori complement
(
33310-33898 )
589 View Details
misc_feature8 33899-34049 151 View Details
Ampicillin complement
(
34050-34910 )
861 View Details
misc_feature 34911-35165 255 View Details
PacI 35166-35173 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

309918ce1c21882ce3bf1a92217a7a71