{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9353gcz
Vector Name:
Vector Type:
Mammalian miR30-shRNA Knockdown Tol2 Vector   Guide 
Vector Size:
4453 bp
Promoter:
CMV
ORF:
EGFP
shRNA:
Scramble[miR30-shRNA]
Target Sequence:
ACCTAAGGTTAAGTCGCCCTCG
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information How to order

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-200 200 View Details
misc_feature1 201-271 71 View Details
attB4 272-292 21 View Details
CMV 293-881 589 View Details
attB1 882-905 24 View Details
Kozak 906-911 6 View Details
EGFP 912-1631 720 View Details
attB2 1632-1655 24 View Details
5' miR-30E 1656-1783 128 View Details
Scramble[miR30-shRNA] 1784-1846 63 View Details
3' miR-30E 1847-1976 130 View Details
attB3 1977-1997 21 View Details
misc_feature5 1998-2015 18 View Details
SV40 late pA 2016-2237 222 View Details
misc_feature6 2238-2271 34 View Details
3' ITR complement
(
2272-2446 )
175 View Details
misc_feature5 2447-2633 187 View Details
pUC ori complement
(
2634-3222 )
589 View Details
misc_feature7 3223-3392 170 View Details
Ampicillin complement
(
3393-4253 )
861 View Details
misc_feature7 4254-4453 200 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

e4a89f8737c2ce10931836fd31ebabab