{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9354ztt
Vector Name:
Vector Type:
Mammalian CRISPR Vector (Single gRNA)   Guide 
Vector Size:
10603 bp
gRNA:
Scramble_gRNA1
Guide Sequence:
GTGTAGTTCGACCATTCGTG
Nuclease:
hCas9
Marker:
EGFP/Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
U6 promoter 1-249 249 View Details
misc_feature 250-250 1 View Details
Scramble_gRNA1 251-346 96 View Details
Terminator 347-352 6 View Details
misc_feature 353-365 13 View Details
CBh promoter 366-1163 798 View Details
misc_feature 1164-1175 12 View Details
hCas9 1176-5447 4272 View Details
misc_feature 5448-5477 30 View Details
BGH pA 5478-5685 208 View Details
misc_feature 5686-5696 11 View Details
CMV promoter 5697-6284 588 View Details
misc_feature6 6285-6315 31 View Details
EGFP/Puro 6316-7632 1317 View Details
Undefined 7633-7635 3 View Details
SV40 late pA 7636-7857 222 View Details
misc_feature7 7858-8922 1065 View Details
Ampicillin 8923-9783 861 View Details
misc_feature12 9784-9953 170 View Details
pUC ori 9954-10542 589 View Details
misc_feature9 10543-10603 61 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

413576df759a1febd95fef403f371c3c