{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9355sqw
Vector Name:
Vector Type:
Mammalian CRISPR Lentiviral Vector (Single gRNA)   Guide 
Vector Size:
11764 bp
Viral Genome Size:
8289 bp undersized genome oversized genome oversized genome
gRNA:
Scramble_gRNA1
Guide Sequence:
GTGTAGTTCGACCATTCGTG
Nuclease:
hCas9:T2A:Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
RSV promoter 1-229 229 View Details
Δ5' LTR 230-410 181 View Details
misc_feature1 411-520 110 View Details
Ψ 521-565 45 View Details
misc_feature2 566-1074 509 View Details
RRE 1075-1308 234 View Details
misc_feature3 1309-1802 494 View Details
cPPT 1803-1920 118 View Details
misc_feature4 1921-1926 6 View Details
U6 promoter 1927-2175 249 View Details
misc_feature 2176-2176 1 View Details
Scramble_gRNA1 2177-2272 96 View Details
Terminator 2273-2278 6 View Details
misc_feature5 2279-2395 117 View Details
EFS promoter 2396-2627 232 View Details
misc_feature8 2628-2657 30 View Details
hCas9:T2A:Puro 2658-7589 4932 View Details
misc_feature9 7590-7620 31 View Details
WPRE 7621-8218 598 View Details
misc_feature11 8219-8283 65 View Details
ΔU3/3' LTR 8284-8518 235 View Details
misc_feature10 8519-8590 72 View Details
SV40 early pA 8591-8725 135 View Details
misc_feature11 8726-9678 953 View Details
Ampicillin 9679-10539 861 View Details
misc_feature12 10540-10709 170 View Details
pUC ori 10710-11298 589 View Details
misc_feature13 11299-11764 466 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

005a5cc4e8c7581a8fb0206356fb13e5