{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9356pna
Vector Name:
Vector Type:
Mammalian CRISPR Adenoviral Vector (Single gRNA)   Guide 
Vector Size:
39715 bp
gRNA:
Scramble_gRNA1
Guide Sequence:
GTGTAGTTCGACCATTCGTG
Nuclease:
hCas9:P2A:EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature1 104-190 87 View Details
Ψ 191-370 180 View Details
misc_feature2 371-536 166 View Details
U6 promoter 537-785 249 View Details
misc_feature 786-786 1 View Details
Scramble_gRNA1 787-882 96 View Details
Terminator 883-888 6 View Details
misc_feature 889-901 13 View Details
CBh promoter 902-1699 798 View Details
Kozak 1700-1705 6 View Details
hCas9:P2A:EGFP 1706-6760 5055 View Details
misc_feature 6761-6765 5 View Details
TK pA 6766-7037 272 View Details
Undefined 7038-7085 48 View Details
ΔAd5 7086-37525 30440 View Details
3' ITR 37526-37628 103 View Details
PacI 37629-37636 8 View Details
misc_feature 37637-37851 215 View Details
pBR322 ori complement
(
37852-38440 )
589 View Details
misc_feature8 38441-38591 151 View Details
Ampicillin complement
(
38592-39452 )
861 View Details
misc_feature 39453-39707 255 View Details
PacI 39708-39715 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

4af664fe35f20e5ff8736695d352a512