{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9358ttk
Vector Name:
Vector Type:
Mammalian Single-gRNA Expression Vector  
Vector Size:
4654 bp
gRNA:
Scramble_gRNA
Guide Sequence:
GCACTACCAGAGCTAACTCA
Marker:
EGFP:P2A:Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
U6 promoter 1-249 249 View Details
misc_feature 250-250 1 View Details
Scramble_gRNA 251-346 96 View Details
Terminator 347-352 6 View Details
misc_feature1 353-463 111 View Details
hPGK promoter 464-968 505 View Details
misc_feature8 969-998 30 View Details
EGFP:P2A:Puro 999-2381 1383 View Details
misc_feature6 2382-2425 44 View Details
SV40 late pA 2426-2647 222 View Details
misc_feature5 2648-2834 187 View Details
pUC ori complement
(
2835-3423 )
589 View Details
misc_feature7 3424-3593 170 View Details
Ampicillin complement
(
3594-4454 )
861 View Details
misc_feature7 4455-4654 200 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

35d8c214214ea00e092f56b164ed9b00