{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9359hhe
Vector Name:
Vector Type:
Mammalian Single-gRNA Expression Lentiviral Vector   Guide 
Vector Size:
8485 bp
Viral Genome Size:
5010 bp undersized genome oversized genome oversized genome
Guide Sequence:
GCACTACCAGAGCTAACTCA

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
RSV promoter 1-229 229 View Details
Delta5' LTR 230-410 181 View Details
misc_feature1 411-520 110 View Details
Psi 521-565 45 View Details
misc_feature2 566-1074 509 View Details
RRE 1075-1308 234 View Details
misc_feature3 1309-1802 494 View Details
cPPT 1803-1920 118 View Details
misc_feature4 1921-1926 6 View Details
U6 promoter 1927-2175 249 View Details
misc_feature5 2176-2176 1 View Details
Scramble_gRNA 2177-2196 20 View Details
gRNA scaffold 2197-2272 76 View Details
Terminator 2273-2278 6 View Details
misc_feature6 2279-2395 117 View Details
PGK promoter 2396-2900 505 View Details
misc_feature7 2901-2930 30 View Details
EGFP:T2A:Puro 2931-4310 1380 View Details
misc_feature8 4311-4341 31 View Details
WPRE 4342-4939 598 View Details
misc_feature9 4940-5004 65 View Details
DeltaU3/3' LTR 5005-5239 235 View Details
misc_feature10 5240-5311 72 View Details
SV40 early pA 5312-5446 135 View Details
misc_feature11 5447-6399 953 View Details
Ampicillin 6400-7260 861 View Details
misc_feature12 7261-7430 170 View Details
pUC ori 7431-8019 589 View Details
misc_feature13 8020-8485 466 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

93204b78e07c942caa324f7e93552e8b