{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9360nph
Vector Name:
Vector Type:
Mammalian Single-gRNA Expression Adenoviral Vector   Guide 
Vector Size:
35088 bp
gRNA:
Scramble_gRNA1
Guide Sequence:
GTGTAGTTCGACCATTCGTG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature1 104-190 87 View Details
Ψ 191-370 180 View Details
misc_feature2 371-536 166 View Details
U6 promoter 537-785 249 View Details
misc_feature 786-786 1 View Details
Scramble_gRNA1 787-882 96 View Details
Terminator 883-888 6 View Details
misc_feature 889-907 19 View Details
hPGK promoter 908-1412 505 View Details
Kozak 1413-1418 6 View Details
EGFP 1419-2138 720 View Details
TK pA 2139-2410 272 View Details
Undefined 2411-2458 48 View Details
ΔAd5 2459-32898 30440 View Details
3' ITR 32899-33001 103 View Details
PacI 33002-33009 8 View Details
misc_feature 33010-33224 215 View Details
pBR322 ori complement
(
33225-33813 )
589 View Details
misc_feature8 33814-33964 151 View Details
Ampicillin complement
(
33965-34825 )
861 View Details
misc_feature 34826-35080 255 View Details
PacI 35081-35088 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

cbb42b9d22847a6a6a36616f68acd916