{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9361zjr
Vector Name:
Vector Type:
Mammalian Single-SagRNA Expression AAV Vector   Guide 
Vector Size:
5407 bp
Viral Genome Size:
2290 bp undersized genome oversized genome oversized genome
gRNA:
Scramble_SagRNA1
Guide Sequence:
GTGTAGTTCGACCATTCGTG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
misc_feature 1-236 236 View Details
5' ITR 237-377 141 View Details
misc_feature1 378-383 6 View Details
U6 promoter 384-632 249 View Details
{n} 633-633 1 View Details
Scramble_SagRNA1 634-729 96 View Details
Terminator 730-734 5 View Details
Undefined 735-768 34 View Details
CMV promoter 769-1357 589 View Details
misc_feature8 1358-1387 30 View Details
EGFP 1388-2107 720 View Details
attB2 2108-2131 24 View Details
misc_feature5 2132-2151 20 View Details
SV40 late pA 2152-2373 222 View Details
misc_feature6 2374-2385 12 View Details
3' ITR complement
(
2386-2526 )
141 View Details
misc_feature7 2527-3606 1080 View Details
Ampicillin 3607-4467 861 View Details
misc_feature12 4468-4637 170 View Details
pUC ori 4638-5226 589 View Details
misc_feature 5227-5407 181 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

f282320c265b84176de709ba7e149058