{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9387zjj
Vector Name:
Vector Type:
Mammalian miR30-shRNA Knockdown Lentiviral Vector   Guide 
Vector Size:
10412 bp
Viral Genome Size:
6937 bp undersized genome oversized genome oversized genome
Promoter:
EF1A
ORF:
mCherry
shRNA:
Scramble[miR30-shRNA]
Target Sequence:
ACCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP:T2A:Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart View how to order

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
RSV promoter 1-229 229 View Details
Δ5' LTR 230-410 181 View Details
misc_feature1 411-520 110 View Details
Ψ 521-565 45 View Details
misc_feature2 566-1074 509 View Details
RRE 1075-1308 234 View Details
misc_feature3 1309-1802 494 View Details
cPPT 1803-1920 118 View Details
misc_feature4 1921-1928 8 View Details
attB4 1929-1949 21 View Details
EF1A 1950-3128 1179 View Details
attB1 3129-3152 24 View Details
Kozak 3153-3158 6 View Details
mCherry 3159-3869 711 View Details
attB2 3870-3893 24 View Details
5' miR-30E 3894-4021 128 View Details
Scramble[miR30-shRNA] 4022-4084 63 View Details
3' miR-30E 4085-4214 130 View Details
attB3 4215-4235 21 View Details
misc_feature8 4236-4243 8 View Details
WPRE 4244-4841 598 View Details
misc_feature9 4842-4862 21 View Details
CMV promoter 4863-5450 588 View Details
misc_feature6 5451-5481 31 View Details
EGFP:T2A:Puro 5482-6861 1380 View Details
misc_feature11 6862-6931 70 View Details
ΔU3/3' LTR 6932-7166 235 View Details
misc_feature10 7167-7238 72 View Details
SV40 early pA 7239-7373 135 View Details
misc_feature11 7374-8326 953 View Details
Ampicillin 8327-9187 861 View Details
misc_feature12 9188-9357 170 View Details
pUC ori 9358-9946 589 View Details
misc_feature13 9947-10412 466 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

7a89afca758f039ced8e55a91036537f