{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9397wgw
Vector Name:
Vector Type:
Mammalian miR30-shRNA Knockdown AAV Vector  
Vector Size:
5460 bp
Viral Genome Size:
2841 bp undersized genome oversized genome oversized genome
Promoter:
CMV
ORF:
EGFP
shRNA:
Scramble_miR30-shRNA
Target Sequence:
ACCTAAGGTTAAGTCGCCCTCG
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart View how to order

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-130 130 View Details
XbaI 131-136 6 View Details
attB4 137-157 21 View Details
CMV 158-746 589 View Details
attB1 747-770 24 View Details
Kozak 771-776 6 View Details
EGFP 777-1496 720 View Details
attB2 1497-1520 24 View Details
5' miR-30E 1521-1648 128 View Details
Scramble_miR30-shRNA 1649-1711 63 View Details
3' miR-30E 1712-1841 130 View Details
attB3 1842-1862 21 View Details
EcoRI 1863-1868 6 View Details
WPRE 1869-2466 598 View Details
misc_feature 2467-2496 30 View Details
BGH pA 2497-2704 208 View Details
Undefined 2705-2711 7 View Details
3' ITR complement
(
2712-2841 )
130 View Details
misc_feature 2842-2852 11 View Details
Undefined 2853-3768 916 View Details
Ampicillin 3769-4629 861 View Details
misc_feature12 4630-4799 170 View Details
pUC ori 4800-5388 589 View Details
misc_feature9 5389-5449 61 View Details
misc_feature 5450-5460 11 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

f0a72ceec4c79e5c207bdc227326759a