{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

Vector Summary

Vector ID:
VB010000-9409uek
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Adenoviral Vector   Guide 
Vector Size:
34997 bp
Viral Genome Size:
32915 bp undersized genome oversized genome oversized genome
shRNA:
LacZ[shRNA#1]
Target Sequence:
GTCGGCTTACGGCGGTGATTT
Marker:
EGFP
Plasmid Copy Number:
Medium
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature1 104-190 87 View Details
Psi 191-370 180 View Details
misc_feature2 371-512 142 View Details
attB1 513-536 24 View Details
U6 promoter 537-785 249 View Details
DeltaAgeI 786-787 2 View Details
LacZ[shRNA#1] 788-835 48 View Details
terminator2 836-840 5 View Details
EcoRI 841-846 6 View Details
undefinded19 847-865 19 View Details
PGK promoter 866-1370 505 View Details
Kozak 1371-1376 6 View Details
EGFP 1377-2096 720 View Details
SV40 late pA 2097-2318 222 View Details
BamHI 2319-2324 6 View Details
attB2 2325-2348 24 View Details
misc_feature6 2349-2366 18 View Details
wt Ad5(DeltaE3) 2367-32812 30446 View Details
3' ITR complement
(
32813-32915 )
103 View Details
PacI 32916-32923 8 View Details
misc_feature7 32924-33138 215 View Details
pUC* ori complement
(
33139-33727 )
589 View Details
misc_feature8 33728-33878 151 View Details
Ampicillin complement
(
33879-34739 )
861 View Details
misc_feature9 34740-34989 250 View Details
PacI 34990-34997 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

f6549b51611c5dc85c3a801cc2f34565