{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9432gnq
Vector Name:
Vector Type:
Mammalian shRNA Knockdown AAV Vector   Guide 
Vector Size:
5344 bp
Viral Genome Size:
2205 bp undersized genome oversized genome oversized genome
shRNA:
Luciferase[shRNA#1]
Target Sequence:
ATGTTTACTACACTCGGATAT
Marker:
mCherry
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed

  • {[ v.product_type|boatFixI18nName:'appVectorOrderInfo'|translate ]}

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-130 130 View Details
misc_feature1 131-136 6 View Details
U6 promoter 137-385 249 View Details
DeltaAgeI 386-387 2 View Details
Luciferase[shRNA#1] 388-435 48 View Details
terminator2 436-440 5 View Details
EcoRI 441-446 6 View Details
misc_feature4 447-467 21 View Details
PGK promoter 468-1056 589 View Details
misc_feature5 1057-1086 30 View Details
mCherry 1087-1797 711 View Details
misc_feature6 1798-1841 44 View Details
SV40 late pA 1842-2063 222 View Details
misc_feature7 2064-2075 12 View Details
3' ITR complement
(
2076-2205 )
130 View Details
misc_feature 2206-2216 11 View Details
misc_feature8 2217-3296 1080 View Details
Ampicillin 3297-4157 861 View Details
misc_feature9 4158-4327 170 View Details
pUC ori 4328-4916 589 View Details
misc_feature10 4917-5333 417 View Details
misc_feature 5334-5344 11 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

56201c04f02f12918d1fcaf92f74fe42