{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9489hhg
Vector Name:
Vector Type:
Mammalian shRNA Knockdown AAV Vector   Guide 
Vector Size:
6497 bp
Viral Genome Size:
3358 bp undersized genome oversized genome
shRNA:
Scramble[shRNA#1]
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information How to order

  • Deliverable:
    E. coli stock
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-130 130 View Details
misc_feature1 131-136 6 View Details
U6 promoter 137-385 249 View Details
DeltaAgeI 386-387 2 View Details
Scramble[shRNA#1] 388-435 48 View Details
Terminator 436-440 5 View Details
EcoRI 441-446 6 View Details
attB4 447-467 21 View Details
CAG promoter 468-2200 1733 View Details
misc_feature8 2201-2230 30 View Details
EGFP 2231-2950 720 View Details
misc_feature6 2951-2994 44 View Details
SV40 late pA 2995-3216 222 View Details
misc_feature6 3217-3228 12 View Details
3' ITR complement
(
3229-3358 )
130 View Details
misc_feature 3359-3369 11 View Details
misc_feature7 3370-4449 1080 View Details
AmpiciIIin 4450-5310 861 View Details
misc_feature12 5311-5480 170 View Details
pUC ori 5481-6069 589 View Details
misc_feature9 6070-6486 417 View Details
Undefined 6487-6497 11 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

c37e1ccd6a72f5f484c819c917f7e605
Request Design Support