Control gRNAs

VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
gRNA Target Sequences
Name Target Sequence + PAM Target Gene Target Position References Sequence
Scramble[gRNA#1]_target GTGTAGTTCGACCATTCGTGTGG None in human and mouse Engineered by VectorBuilder View
ROSA26[gRNA#1]_target CGCCCATCTTCTAGAAAGACTGG Mouse ROSA26 locus 1st intron Designed by VectorBuilder View
AAVS1[gRNA#1]_target GGGGCCACTAGGGACAGGATTGG Human AAVS1 locus 1st intron Science. 339:823 (2013) View
Scramble[SagRNA#1]_target GTGTAGTTCGACCATTCGTGGGGAGT None in human and mouse Engineered by VectorBuilder View
EMX1[SagRNA#1]_target GGCCTCCCCAAAGCCTGGCCAGGGAGT Human EMX1 3rd exon Nature. 520:186 (2015) View