VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
gRNA Target Sequences
Name | Target Sequence + PAM | Target Gene | Target Position | References | Sequence |
---|---|---|---|---|---|
Scramble[gRNA#1]_target | GTGTAGTTCGACCATTCGTGTGG | None in human and mouse | Engineered by VectorBuilder | View | |
ROSA26[gRNA#1]_target | CGCCCATCTTCTAGAAAGACTGG | Mouse ROSA26 locus | 1st intron | Designed by VectorBuilder | View |
AAVS1[gRNA#1]_target | GGGGCCACTAGGGACAGGATTGG | Human AAVS1 locus | 1st intron | Science. 339:823 (2013) | View |
Scramble[SagRNA#1]_target | GTGTAGTTCGACCATTCGTGGGGAGT | None in human and mouse | Engineered by VectorBuilder | View | |
EMX1[SagRNA#1]_target | GGCCTCCCCAAAGCCTGGCCAGGGAGT | Human EMX1 | 3rd exon | Nature. 520:186 (2015) | View |