Popular gRNA Sequences

VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
Popular gRNA
NameGuide SequenceTarget GeneTarget PositionReferencesSequence
Scramble[gRNA#1]GTGTAGTTCGACCATTCGTGNone in human and mouseEngineered by VectorBuilder View
Scramble[gRNA#2]GTTCAGGATCACGTTACCGCNone in human and mouseEngineered by VectorBuilder View
Scramble[SagRNA#1]GTGTAGTTCGACCATTCGTGNone in human and mouseEngineered by VectorBuilder View
Scramble[SagRNA#2]GTTCAGGATCACGTTACCGCNone in human and mouseEngineered by VectorBuilder View
Scramble[msgRNA#1]GTGTAGTTCGACCATTCGTGNone in human and mouseEngineered by VectorBuilder View
Scramble[msgRNA#2]GTTCAGGATCACGTTACCGCNone in human and mouseEngineered by VectorBuilder View
EGFP[gRNA#1]GGGCGAGGAGCTGTTCACCGEGFP12-31Science. 343:84 (2014) View
EGFP[gRNA#2]GAAGTTCGAGGGCGACACCCEGFP339-358Science. 343:84 (2014) View
ROSA26[gRNA#1]CGCCCATCTTCTAGAAAGACMouse ROSA26 locus1st intronDesigned by VectorBuilder View
AAVS1[gRNA#1]GGGGCCACTAGGGACAGGATHuman AAVS1 locus1st intronScience. 339:823 (2013) View
EMX1[SagRNA#1]GGCCTCCCCAAAGCCTGGCCAHuman EMX13rd exonEngineered by VectorBuilder View
Scramble[msSagRNA#1]GTGTAGTTCGACCATTCGTGNone in human and mouseEngineered by VectorBuilder View
Scramble[msSagRNA#2]GTTCAGGATCACGTTACCGCNone in human and mouseEngineered by VectorBuilder View
ttTi5605[gRNA#1]GATATCAGTCTGTTTCGTAAC. elegans ttTi5605 locusAdjacent to the ttTi5605 Mos1 insertion site on chromosome IINat Methods. 10:1028 (2013) View
Design My Vector Request Design Support