VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
Popular gRNA
| Name | Guide Sequence | Target Gene | Target Position | References | Sequence |
|---|---|---|---|---|---|
| Scramble[gRNA#1] | GTGTAGTTCGACCATTCGTG | None in human and mouse | Engineered by VectorBuilder | View | |
| Scramble[gRNA#2] | GTTCAGGATCACGTTACCGC | None in human and mouse | Engineered by VectorBuilder | View | |
| Scramble[SagRNA#1] | GTGTAGTTCGACCATTCGTG | None in human and mouse | Engineered by VectorBuilder | View | |
| Scramble[SagRNA#2] | GTTCAGGATCACGTTACCGC | None in human and mouse | Engineered by VectorBuilder | View | |
| Scramble[msgRNA#1] | GTGTAGTTCGACCATTCGTG | None in human and mouse | Engineered by VectorBuilder | View | |
| Scramble[msgRNA#2] | GTTCAGGATCACGTTACCGC | None in human and mouse | Engineered by VectorBuilder | View | |
| EGFP[gRNA#1] | GGGCGAGGAGCTGTTCACCG | EGFP | 12-31 | Science. 343:84 (2014) | View |
| EGFP[gRNA#2] | GAAGTTCGAGGGCGACACCC | EGFP | 339-358 | Science. 343:84 (2014) | View |
| ROSA26[gRNA#1] | CGCCCATCTTCTAGAAAGAC | Mouse ROSA26 locus | 1st intron | Designed by VectorBuilder | View |
| AAVS1[gRNA#1] | GGGGCCACTAGGGACAGGAT | human AAVS1 locus | Human AAVS1 locus | Science. 339:823 (2013) | View |
| EMX1[SagRNA#1] | GGCCTCCCCAAAGCCTGGCCA | Human EMX1 | 3rd exon | Engineered by VectorBuilder | View |
| Scramble[msSagRNA#1] | GTGTAGTTCGACCATTCGTG | None in human and mouse | Engineered by VectorBuilder | View | |
| Scramble[msSagRNA#2] | GTTCAGGATCACGTTACCGC | None in human and mouse | Engineered by VectorBuilder | View | |
| ttTi5605[gRNA#1] | GATATCAGTCTGTTTCGTAA | C. elegans ttTi5605 locus | Adjacent to the ttTi5605 Mos1 insertion site on chromosome II | Nat Methods. 10:1028 (2013) | View |