Popular gRNA Sequences

VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
Name Guide Sequence Target Gene Target Position References Sequence
Scramble[gRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[gRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
Scramble[SagRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[SagRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
Scramble[msgRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[msgRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
ROSA26[gRNA#1] CGCCCATCTTCTAGAAAGAC Mouse ROSA26 locus 1st intron Designed by VectorBuilder View
AAVS1[gRNA#1] GGGGCCACTAGGGACAGGAT Human AAVS1 locus 1st intron Science. 339:823 (2013) View
EMX1[SagRNA#1] GGCCTCCCCAAAGCCTGGCCA Human EMX1 3rd exon Engineered by VectorBuilder View
Scramble[msSagRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[msSagRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View