Popular shRNA Sequences

VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
Name Target Sequence Target Gene Target Position References Sequence
Scramble[shRNA#1] CCTAAGGTTAAGTCGCCCTCG None in human and mouse Cancer Res. 66:9270 (2006) View
Scramble[shRNA#2] CAACAAGATGAAGAGCACCAA TurboGFP; none in human and mouse Oncogene. 30:1551 (2011); Science. 343:309 (2014) View
EGFP[shRNA#1] CGACGTAAACGGCCACAAGTT EGFP 63-83 The RNAi Consortium ID: TRCN0000072193 View
EGFP[shRNA#2] ACGTCTATATCATGGCCGACA EGFP 449-469 The RNAi Consortium ID: TRCN0000231756 View
LacZ[shRNA#1] GTCGGCTTACGGCGGTGATTT LacZ 1734-1754 The RNAi Consortium ID: TRCN0000072242 View
LacZ[shRNA#2] GTTCCGTCATAGCGATAACGA LacZ 1908-1928 The RNAi Consortium ID: TRCN0000072238 View
Luciferase[shRNA#1] ATGTTTACTACACTCGGATAT Firefly luciferase 745-765 The RNAi Consortium ID: TRCN0000231737 View
Luciferase[shRNA#2] TGTCCGGTTATGTAAACAATC Firefly luciferase 1193-1213 The RNAi Consortium ID: TRCN0000072258 View
Scramble[miR30-shRNA#1] ACCTAAGGTTAAGTCGCCCTCG None in human and mouse Designed by VectorBuilder View
Scramble[miR30-shRNA#2] CCAACAAGATGAAGAGCACCAA TurboGFP; none in human and mouse Oncogene. 30:1551 (2011); Science. 343:309 (2014) View
EGFP[miR30-shRNA#1] GCGACGTAAACGGCCACAAGTT EGFP 62-83 Designed by VectorBuilder View
EGFP[miR30-shRNA#2] AACGTCTATATCATGGCCGACA EGFP 448-469 Designed by VectorBuilder View
EGFP[miR30-shRNA#3] CATGGACGAGCTGTACAAGTAA EGFP 699-720 Designed by VectorBuilder View
EGFP[miR30-shRNA#4] CACATGAAGCAGCACGACTTCT EGFP 232-253 Designed by VectorBuilder View